Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assignment : Application: Evaluation Project

Part : Evaluation Tool

Proper measurement requires identifying the correct measurement tool. Would you measure a patient's temperature using a meat thermometer? Without the correct tool, any answer that you generate to a question of interest will have little or no basis in reality. Similarly, when seeking to answer a PICO question, you must ensure that you have the right evaluation tool for the situation. An evaluation tool should make reliable and valid measurements that are relevant to the question at hand. In this part of your Evaluation Project, you select an evaluation tool that you believe to be most appropriate for use in addressing your PICO question. You also develop a plan for utilizing the selected tool in your evaluation process.

To prepare:

Review the concepts of reliability and validity as covered in this week's Learning Resources.

Review the research design of your Evaluation Project.

Think about criteria you may use to define the success of your evaluation plan. What tool could measure these criteria?

Explore the available tools used in system evaluation, focusing on the tools listed on the AHRQ website.

Select an evaluation tool that you believe would be most appropriate for your Evaluation Project.

To complete Part 5 of this Evaluation Project:

In a 2- to 3-page paper,

1) Describe the evaluation tool that you selected for your Evaluation Project.

2) Provide a rationale for your selection, and summarize the criteria you will use to define the success of the evaluation.

3) Develop a plan for utilizing the tool for your Evaluation Methodology Plan. If the tool that you selected is not on the AHRQ website, provide evidence that it is a valid and reliable tool.

Required Readings

Friedman, C. P., & Wyatt, J. C. (2010). Evaluation methods in biomedical informatics (2nd ed.). New York, NY: Springer Science+Business Media, Inc.

Chapter 5, "Measurement Fundamentals" (pp. 113-144)

This chapter details the importance of reliability and validity in measurement in informatics. It defines the different types of validity and introduces statistical equations for accurately determining the reliability and validity of a research finding.

Anderson, E. F. (2011). A case for measuring governance. Nursing Administration Quarterly, 35(3), 197-203.

Retrieved from the Walden Library databases.

The author of this article describes the Index of Professional Nursing Governance, which is a tool used to measure the degree and implementation of shared governance. The author presents a case in which the index was used in a hospital to assess the degree of shared governance over time.

Kaphingst, K. A., Kreuter, M. W., Casey, C., Leme, L., Thompson, T., Cheng, M. R., et al. (2012). Health literacy INDEX: Development, reliability, and validity of a new tool for evaluating the health literacy demands of health information materials. Journal of Health Communication, 17(Supp 3), 203-221.

Retrieved from the Walden Library databases.

In this article, the authors describe the development, refinement, and testing of Health Literacy INDEX, a tool designed to determine criteria for judging the quality of health information materials.

Penfold, R. B., Kullgren, J. T., Miroshnik, I., Galbraith, A. A., Hinrichsen, V. L., & Lieu, T. A. (2011). Reliability of a patient survey assessing cost-related changes in health care use among high deductible health plan enrollees. BMC Health Services Research, 11(1), 133-143.
Retrieved from the Walden Library databases.

This article describes a study that sought to determine the reliability of survey questions used to measure the behaviors and knowledge of high-deductible health plan beneficiaries. The authors of the article highlight their findings after conducting control and trial surveys among the beneficiaries.

Seto, I., Foisy, M., Arkison, B., Klassen, T., & Williams, K. (2012). The evaluation of an evidence-based clinical answer format for pediatricians. BMC Pediatrics, 12, 34-41.

Retrieved from the Walden Library databases.

The authors of this article describe a tool (Clinical Answers) that supplies the user with summaries of key medical evidence-based practices. They highlight a survey given to pediatricians to examine their use of Clinical Answers and to garner ways the product could be improved.

Agency for Healthcare Research and Quality. (n.d.). Health IT survey compendium. Retrieved from

http://healthit.ahrq.gov/portal/server.pt/community/health_it_tools_and_resources/919/health_it_survey_compendium/27874

Required Media

Laureate Education (Producer). (n.d.f). Reliability and validity. Retrieved from CDN database. (NURS 6431)

This video explores the concepts of reliability and validity in measurement tools. The video stresses the importance of reliability and validity when selecting an appropriate tool to evaluate a PICO question.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92175468
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Case study plain view open fields abandonment and border

Case Study : Plain View, Open Fields, Abandonment, and Border Searches as They Relate to Search and Seizures Officer Jones asked the neighborhood's regular trash collector to put the content of the defendant's garbage th ...

For this assessment you will visit this link from the texas

For this assessment, you will visit this link from the Texas Tribune "texastribune" and then answer the following questions: What is redistricting? What is gerrymandering? How do both of these play into campaigns and ele ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Our first individual paper invites your interpretation and

Our first individual paper invites your interpretation and application of course texts and concepts in relation to some specific element of contemporary public culture. By the time this comes due, we will have read and d ...

Watch tough on crime policies and respond to the following

Watch Tough on Crime Policies and respond to the following prompt. Prompt: Microviews of delinquency involve looking at individual delinquents and trying to decipher why they commit delinquent acts. Macroviews of delinqu ...

Question choose 4 questions1 what kind of screening do

Question: Choose 4 questions 1. What kind of screening do psychologists go through to find out if they have any psychological disorders before being licensed? 2. Can a psychologist counsel a friend? Is it ever beneficial ...

Quesiton according to the american diabetes association

Quesiton: According to the American Diabetes Association (2011), 25.8 million children and adults have been diagnosed with diabetes in the United States. Approximately 2 million more are diagnosed every year, with anothe ...

Please read the navigating in stormy waters case study

Please read the Navigating in Stormy Waters case study. Address the following questions related to the text through the forum format. You are required to post your views to the questions before you will have access to vi ...

Quesiton about your signature assignmentsignaturebenchmark

Quesiton: About Your Signature Assignment Signature/Benchmark Assignments are designed to align with specific program student learning outcome(s) in your program. Program Student Learning Outcomes are broad statements th ...

Manage employee relationspart -1develop an employee

Manage employee relations Part -1: Develop an employee relations strategy Performance objective For this assessment task, you will demonstrate the skills and knowledge necessary for developing an employee relations strat ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As