Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

Assessment 1: Self-Assessment

Complete the "Career Planning Based on Brain Dominance and Thinking Styles" self-inventory and consult the list of careers best suited to your primary thinking style. Then post a new thread to this discussion board that addresses the following:

• What were your scores in each of the four modes?

• Based on the numerical scores you received, what is your primary thinking style? What is your secondary preference?

• According to the self-assessment, what are the characteristics associated with your primary thinking style? Do you agree or disagree with these characteristics? Explain.

• What are some of the career choices suited to your thinking style? Would you be interested in pursuing any of these careers? Why or why not?

• Are there any careers listed for which you know you are not suited? Explain.

This posting, consisting of a minimum of 4 full paragraphs(at least 500), must include chapter ideas and concepts to support your answers. Please make certain to cite any outside sources used.

Career Planning Based on Brain Dominance and Thinking Styles

My scores in each of the four modes were as follows:

Total points for A: 66 (primarily represent the left-brain mode)
Total points for B: 62 (primarily represent the right-brain mode)
Total points for C: 61 (primarily represent the right-brain mode)
Total points for D: 61 (primarily represent the left-brain mode)

Based on the numerical scores I received, my primary thinking style is A (left brain). Left brain thinkers are logical, use reasoning, serious, knowledgable, and organized. My secondary preference is B (right brain). Right brain thinkers are imaginative, creative, insightful, intuitive, humorous and playful.

According to the self-assessment, the characteristics associated with my primary thinking style are problem solving attributes of people who are characterized as analytical, logical, rational, and critical and who are talented in technical or quantitative areas. I would agree with this assessment. I love order and organization. I enjoy planning. Every January, my husband and I will hold a goals meeting and strategize all the items we want to acquire or accomplish for the year. At this time, we also assess what we accomplished last year and what we didn't and find out why we didn't and move that item to this year. We also assess our goals for 5 and 10 years. We also have a goals meeting with our kids and create story boards. They cut out pictures from magazines and paste them on poster board and write out what they want and how they are going to obtain it over the next year. They create SMART goals for themselves. I think this creates vision for them and helps to makes their individual goals more realistic.

Some of the career choices suited to my thinking style are personnel/ organizational, development, entrepreneurship, and marketing/advising. I am interested in all of these career choices and feel I have some experience in these areas with my current job. I enjoy writing business plans and creating action plans for what I want to accomplish for the year. I record monthly goals in a Day-Timer. I have a meeting with my managing broker each year to go over my career goals and do a last year assessment. We strategize what I can be doing better and what items are a waste of time and what things I can do to introduce into my business plan. Currently, I have a land project going on which requires tremendous planning and organizing.

There were a few careers listed that I would not be suited for. I don't think I would enjoy library science or anything to do with arts and design. I have never been artistic with drawing or painting.

Assessment 2: Legal/Ethical Challenge assignment

Read the Chapter 6 Legal/Ethical Challenge "Should Companies Be Pressured to Recruit Females for Boards of Directors?" on p. 198-199.

Answer the question, "Where do you stand on this issue?" using the options included at the end of the assignment, in a 2-3 page essay (excluding cover page, attachments, etc.), double-spaced, using 12-point font and 1-inch margins. (at least 600words).

Keep in mind that, while there are no "absolutely correct" answers for these questions, this is not an opportunity for opinion alone. Grading will reflect your reasoning and critical thinking skills, your ability to integrate what you have assimilated from material presented in the textbook and other learning materials, the clarity of your response and its appearance.

Should Companies Be Pressured to Recruit Females for Boards of Directors?

A company's board of directors plays a role in the strategic management process. Not only can a board provide input into the planning process, but it ultimately signs off on the intended strategies. Interestingly, a 2011 study by Catalyst, a nonprofit organization, compared financial performance of companies with zero female board members versus those with three or more female members. Results indicated that female representation was associated with (1) 84% higher return on sales, (2) 60% higher return on invested capital, and (3) 46% higher return on equity. This challenge pertains to whether it is ap-propriate for outside groups to pressure a company to include women on its board of directors.

Small percentages of female board members may be caused by many factors, such as a lack of specific experience (e.g., finance), limited social networks, and negative stereotypes. Regardless of the cause, external groups are sprouting up around the United States that are focused on putting pressure on companies to recruit female directors. One example is a group that calls itself "2020 Women on Boards." This
nonprofit group has a goal of mobilizing stakeholders to encourage companies to increase female represen-tation on boards of directors. The group plans to pub-lish a list of the Fortune 1000 companies that have no female directors. Some believe that efforts like this will promote good corporate governance, while others see it as an intrusion into the internal functioning of an organization.

SOLVING THE CHALLENGE Where do you stand on this issue?

1. It is a great idea to pressure companies to include more females on boards of directors. After all, the Catalyst study showed that female representation was associated with higher financial performance.

2. Companies should be allowed to select people for boards based on their experience, networks, and per-formance. Gender should not be considered as a relevant criterion for selecting board members. I am not in favor of this type of social pressure because it does not ensure that the most qualified people are placed on boards of directors.

Assessment 3

Leadership has many forms. Discuss the type of leader you work best with and discuss why you enjoy this type of leadership. Also discuss the type of leadership that you find hardest to work with. Discuss what type of leader you are. NOW....can leadership be taught or are you born with it? Defend your answers.

Your initial discussion should be at least 400 words.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92690634
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Assignment - project overview non-profit campaigncreate a 6

Assignment - Project Overview: Non-Profit Campaign Create a 6 slide ppt on organization according to given requirements. Write minimum one page document that provides all of the following: 1. The name of the organization ...

Question - there are 2 bacteria names given below need to

Question - There are 2 bacteria names given below, need to write information about them in 1 page each. 1. Roseburia inulinivorans 2. Coprococcus catus Total Words: 350+350 = 700.

Revise the following paragraph so that each sentence or

Revise the following paragraph so that each sentence (or most sentences) adhere to the known-new technique: The use of 24-hour lighting and feed systems to mass-produce chickens is a dangerous practice. Chickens grow twe ...

Please read it firsteach activity should be consist on

PLEASE READ IT FIRST. Each activity should be consist on atleast 300 words ACTIVITY 1 : Choose a film that you have seen recently, and which you particularly enjoyed. Now find a friend or colleague who has seen the same ...

Question explain the strengths and weaknesses of

Question : Explain the strengths and weaknesses of victimization theories while considering their impact on victims OR explain how biochemical conditions and brain activity could be linked to crime from a theoretical per ...

Question in your clc group create a powerpoint presentation

Question: In your CLC group, create a PowerPoint presentation of 10-15 slides in which you compare the pros and cons of continuing nursing education related to the following: 1. Impact on competency. 2. Impact on knowled ...

Understanding the digital revolution - video and disruption

Understanding the Digital Revolution - Video and Disruption Report Assignment Overview - For this assessment task, you will create a two-minute video and written proposal about the impact of a particular technology on an ...

Understanding the digital revolution - video and disruption

Understanding the Digital Revolution - Video and Disruption Report Assignment Overview - For this assessment task, you will create a two-minute video and written proposal about the impact of a particular technology on an ...

Assessment task - planning implementation and evaluation of

Assessment task - Planning, implementation and evaluation of a non-communicable disease prevention initiative This assignment uses a suburban state primary school as a setting for the prevention of overweight and obesity ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As