Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

About 1 or 1 and half pages for each question

I need the writer to use certain concepts that we used in class. I will be sending all my class notes so the writer can go through ad use some of these concepts to write a very good paper

Below are situations and questions that relate to the materials that we covered in class

Question One

You are a current employee of Cookies n Cream a leading producer of specialty cookies. Cookie sales have fallen recently, due to the recession and an unfortunate situation involving Cookies n Cream products, a golf icon and an inadvertent photo. You are working as part of a team looking at new products, both in and out of the cookie industry. You've concluded that CnC is heading for disaster and decide to look for something to do with your expensive MBA. A friend of yours, Marillee Ouigo, has approached you about helping her start a new cupcake store in Georgetown. How would you approach, aw21wsxxw2q1identify and think through the various issues relating to you helping her start this new business?

Question Two

You are currently a Vice President of Marketing at Coolapps, Inc. Coolapps does service work for companies looking to create web and mobile apps to promote their businesses. Over the weekend, you were visiting a popular restaurant in Adams Morgan and looked at all of the people with their heads buried in their phones and you've decided that what the world really needs is a mobile app that would allow young professionals to see the profiles of the people that are around them, and see what they like, who they know, etc. You have a friend at Coolapps that is a terrific developer, who has told you he wants to start a business with you. And, you have a wealthy uncle who has told you he will provide you with $1,000,000 to start any business you want. All good news. One bit of bad news - Captain Maudlin's Rum ("the rum to drink when you are drinking alone") has decided to change its image by asking Coolapps to create an app to allow people to see who else is in the bar. Captain Maudlin is not your client (you are too happy a person) but you know about the engagement.You have decided to start this new business. What are the various issues that you need to think through?

Question Three

You are the founder of a software startup called Guggle. It's like Google, only different. You've been working hard on the business since 2013, when you formed it with two other founders. Ray and Dar. Ray left the company after six months. Dar is still with you and is the director of engineering. In 2014 you raised one round of venture capital from Octopus Ventures (trademark: "for VCs we don't suck") and took in $10 million dollars in a Series A investment. Your business has not grown particularly rapidly, and you are generating enough revenue to break even and cover the expenses of managing the business but not much else. You have spent all of Octopus's investment. Facebook has approached you about a doing a deal where they will purchase Guggle's assets in an asset sale for $10 million dollars. You are trying to decide what to do. Based upon what have talked about in class, what are the main issues that you will have to address to reach a decision?

Question Four

Congratulations. Your startup is doing great! Lots of people want to invest in your company, even though you are still cash flow negative. By your estimation you need $5 million dollars to become cash flow break even. You have been approached by both angel and venture investors. How would you decide between them? And, when making the decision consider the structural differences in how angels and VCs approach deals, as well as the various other pros/cons in choosing one over the other.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91699802
  • Price:- $70

Guranteed 36 Hours Delivery, In Price:- $70

Have any Question?


Related Questions in Homework Help/Study Tips

Quesiton please answer these 2 questions and put in apa

Quesiton: Please answer these 2 questions and put in apa format and any references 1) What are potential problems with having a staffing process in which vacancies are filled (1) on a lottery basis from among job applica ...

Assignment 1 application of crisis theory and resiliency

Assignment 1: Application of Crisis Theory and Resiliency Theory to a Case Study It is common for social workers to be presented with a crisis situation brought forth by clients, families, communities, and/or organizatio ...

Question conduct an internet search about the murder of

Question: Conduct an internet search about the murder of Yeardley Love. After researching the story, write a 500¬-750-word essay addressing the following. 1. Assuming there was abuse occurring prior to the death of Yeard ...

Question the owner of a local ice cream shop which makes

Question: The owner of a local ice cream shop, which makes homemade ice cream, recently bought a very expensive industrial-sized mixer so that the shop could make bigger batches of ice cream at once. At first he thought ...

Question theory and educationcollapseplease review the

Question: Theory and EducationCOLLAPSE Please review the McEwen and Wills (2014) chapter 21: Theoretical Issues in Nursing Curricula and Nursing Instruction and complete the following steps for your initial discussion po ...

Question no plagiarism pleasewill need minimum of 300 words

Question: No plagiarism please. Will need minimum of 300 words, APA Style, double spaced, times new roman, font 12, and Include: (3 references within years 2015-2018) with intext citations. Topic: Pediatric Conditions Up ...

Question george clinton and parliament utilized business

Question: George Clinton and Parliament utilized business and artistic concepts from both James Brown and glam rock acts. How did this provide a unique approach to funk music? Are they influential to later acts? Are they ...

1 differentiate between traditional case management and

1. Differentiate between traditional case management and case management today. 2. Explain the different roles and responsibilities of a case manager. 3. Describe the phases of the helping process. 4. Apply the strengths ...

Question comment 1 prior to the passing of the patient

Question: Comment 1: Prior to the passing of the Patient Protection and Affordable Care Act (PPACA) of 2010, the health care system was fragmented. There was no one single entity responsible for the overall coordination ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As