+61-413 786 465
info@mywordsolution.com
Home >> Homework Help/Study Tips
A wind turbine designed for a tip-speed ratio λ = 9, is operating in a mean wind speed of 12 m s-1. The turbine blades are 50 m long. Estimate the number of revolutions made by the turbine in 30 years taking the capacity factor as 30%.
Homework Help/Study Tips, Others
Priced at $20 Now at $10, Verified Solution
This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...
Question: A renewable energy system is being evaluated by an office building, its initial cost is $25,850. This system is estimated to provide energy savings equivalent to a cut-off of $5,250 from the annual electricity ...
Question: In his article "A Lesson on Elementary, Worldly Wisdom as it Relates to Investment Management & Business," Charles Munger (1995) wrote about tools, techniques, and critical skills that great managers need to de ...
Question: Write a research paper that analyzes methods used to appropriately manage teams and groups within organizations. In your research paper, be sure to include the following elements: 1) Distinguish between a group ...
Prepare: In preparation for discussing the importance of critical thinking skills, please read the following articles: Critical Thinking and the Challenges of Internet and Common Misconceptions of Critical Thinking. You ...
Question: Describe one innovative health care delivery model that incorporates an interdisciplinary care delivery team. How is this advantageous to patient outcomes? The response must be typed, single spaced, must be in ...
Question: Suppose you are the Director of Accounting for a company that has just purchased another company. You are charged with merging the newly purchased company's accounting department into your own, and bringing Sta ...
Question: 1,200-1,500 words Complete the following for this assignment: 1. Define entrepreneurship, and cite your definition. • Explain how entrepreneurs are likely to face extreme situations while working on their ventu ...
Assignment - Choose a real-life service organisation that you are familiar with. Prepare a flowchart of the back-stage as well as the front-stage operations of this business. Using this flowchart, explain the significanc ...
Analytic Report: Purpose: The purpose of this task is to provide students with practical experience in working in teams to write a Data Analytical report to provide useful insights, pattern and trends in the chosen/given ...
Start excelling in your Courses, Get help with Assignment Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.
Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate
Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p
Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As
Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int
Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As