Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

A suspect is apprehended in a large-chain grocery store by the security guard. The suspect is placed in handcuffs and taken to the manager's office. The police are called and advised of the situation. Officer Jones arrives at the store approximately 12 minutes later. Officer Jones takes a statement from the security guard and views the in-store camera film of the shop lifting incident. Officer Jones places the suspect under arrest, reads the suspect the Miranda warnings, and asks the suspect if he would like to make a statement. The suspect replies, "No, I would like a lawyer". The suspect is then transported to the local jail and booked. Five (5) hours later, the suspect is interviewed by a detective who again reads him the Miranda warning. The detective then asks the suspect if he would like to talk. The suspect says, "Yes". He eventually confesses to the crime.

one to two (1-2) page paper in which you:

Identify and discuss the constitutional amendments that would relate to this situation.

Discuss how the Edwards Rule is related to this situation.

In your opinion, determine if the suspect's confession to the detective is admissible.

Use at least two (2) quality references. Note: Wikipedia and other Websites do not qualify as academic resources

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92441945
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question imagine that two focus groups have been conducted

Question: Imagine that two focus groups have been conducted in an Asian American and immigrant community in a large urban city. The rationale of conducting the qualitative study was because it has been noted that many As ...

Question prompt dayer-berenson ch 41 what potential areas

Question: Prompt: Dayer-Berenson, Ch. 4 1. What potential areas of diversity exist in your practice community? 2. How might you learn more about your local community and its unique needs? What are the barriers to meeting ...

Question health inspection research assignmentstudents will

Question: Health Inspection Research Assignment: Students will research a failed restaurant from the SNHD reports and provide a recap as well as recommendations for how the licensee could have avoided the reported failur ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question 1 evaluate the patterns of behavior of early

Question: 1. Evaluate the patterns of behavior of early adapters versus followers. Determine the pattern of behavior that leads to a competitive advantage. Justify your response. 2. Give your opinion as to whether "Heat ...

Question a feasibility analysis is a chance to open your

Question: A feasibility analysis is a chance to open your eyes, ask yourself some very tough questions, then check to see whether your idea, as originally conceived, needs to be modified, refocused, or changed dramatical ...

Assignment - develop menus for special dietary

Assignment - Develop menus for special dietary requirements ASSESSMENT - Project Part A - For this assessment, you must develop the following menus or meal plans: Meal plans Vegetarian, Halal, Suitable for a Coeliac, Kos ...

Question stark lawcase study review this scenariotwo

Question: Stark Law Case Study: Review this scenario: Two physicians, Dr. S. and Dr. V., leased a nuclear camera so they would no longer have to refer their patients to the local hospital for nuclear imaging. Faced with ...

Question start by reading and following these instructions1

Question: Start by reading and following these instructions: 1. Quickly skim the questions or assignment below and the assignment rubric to help you focus. 2. Read the required chapter(s) of the textbook and any addition ...

Question 525-word summary of the concepts related to

Question: 525-word summary of the concepts related to deviance and social inequalities. Ensure you do the following: • Describe the concept of deviance. • Describe how each sociological perspective explains deviance. • D ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As