Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

A study wants to examine the relationship between student anxiety for an exam and the number of hours studied. The data is as follows:

Student Anxiety Scores Study Hours
5 1
10 6
5 2
11 8
12 5
4 1
3 4
2 6
6 5
1 2

1. Why is a correlation the most appropriate statistic?

2. What is the null and alternate hypothesis?

3. What is the correlation between student anxiety scores and number of study hours? Select alpha and interpret your findings. Make sure to note whether it is significant or not and what the effect size is.

4. How would you interpret this?

5. What is the probability of a type I error? What does this mean?

6. How would you use this same information but set it up in a way that allows you to conduct a t-test? An ANOVA?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91726872
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Discussion your first patient has a musculoskeletal

Discussion: Your first patient has a musculoskeletal complaint. Using the chart of musculoskeletal medical word elements from your textbook, construct 10 medical terms that would reasonably be involved in a complaint dea ...

Discussion questionpolice commanders will soon have the

Discussion question: Police commanders will soon have the technical capability to sit in the police station and monitor what all of their officers are doing in the field, thanks to miniature video cameras that can be wor ...

Assessment requirementsthis assessment item is made up of

Assessment requirements This assessment item is made up of two parts. Both parts are based on a case study. In this instance, the case study is actually a news article which you can find here: Article - Origin Energy ign ...

Question select a website of your choosing that sells

Question: Select a website of your choosing that sells products or services. Note: You will use this website for both the Week 3 and 4 individual assignments. Research the company to gather additional information (e.g., ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question on the discussion forum describe an instance of

Question: On the discussion forum, describe an instance of plagiarism or other use of another's intellectual property with which you are familiar. Please give one argument condemning this conduct and one argument defendi ...

Question discuss different types of possible disciplinary

Question: Discuss different types of possible disciplinary actions that are negotiated and how disciplinary procedures affect the labor-management agreement. The response must be typed, single spaced, must be in times ne ...

How do you think obesity impacts a childs development in

How do you think obesity impacts a child's development in the domains of cognitive, social-emotional, and physical development.

Question 1 in your post answer at least three of the

Question: 1. In your post, answer at least three of the following questions: 2. What does literature offer an individual? 3. How has the importance of reading changed from earlier eras (pre-digital/audio/visual media) to ...

Question 1 how does amy cuddys ted talk about your body

Question: 1) How does Amy Cuddy's TED Talk about Your Body Language Shapes Who You Are connect with Mehrabian's study? How can this knowledge help us with increasing team effectiveness through communication? Your Body La ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As