A explain the concept of cover how is cover similar or, Ask an Expert

Others

A. Explain the concept of "cover". How is "cover" similar or analogous to "mitigation of damages" under ordinary contract law?

B. If I am a buyer of goods and the seller repudiates or fails to deliver what I purchased, what remedies do I have besides "cover"? If I am entitled to recover monetary damages from the seller, what can I get?

C. Why do we look to the market price at the place of delivery to determine the buyer's damages? Say the place of delivery is somewhere other than the buyer's business address. Can you think of an example in which the market price might be lower in the area local to the seller? In that case, might the seller prefer a damage calculation based on the seller's local market? How might the seller plan ahead, just in case something goes haywire?

View complete question

Homework Help/Study Tips, Others

Category:- Homework Help/Study Tips
Reference No.:- M9859259

Have any Question?Write your Review or question?

Related Questions in Homework Help/Study Tips

Question advocating for new practice approaches through

Question: Advocating for New Practice Approaches Through Policy "I think one's feelings waste themselves in words; they ought all to be distilled into actions which bring results." -Florence Nightingale Through the polic ...

Assignment - annotated bibliography do an annotated

Assignment - Annotated Bibliography Do an annotated bibliography on the topic. Research Project Topic: Should the U.S. government now rely more on monetary policy or fiscal policy to promote full employment, price stabil ...

Question pick a topic relevant to the information we have

Question: Pick a topic relevant to the information we have covered to date, including this week. It can cover information in Chapters 1,2,3, and 9, or any of the articles presented in the readings area. The format of you ...

Question you are in charge of evaluating the security roles

Question: You are in charge of evaluating the security roles and responsibilities of your organization or an organization you are familiar with. You are also to evaluate the separation of duties which protects secure inf ...

Question the greeks believed strongly in the concept of

Question: The Greeks believed strongly in the concept of fate, and that the gods who ordered the universe were in control of every human's destiny. But by the time of Sophocles, many were questioning the ancient wisdom. ...

Discussion 1very young children are usually highly

Discussion 1 Very young children are usually highly motivated to learn (such as exploring gravity by dropping things from the highchair), but this often declines as they grow. With your readings in mind, think about your ...

Assignmentfor this assignment you are to ponder some

Assignment For this assignment, you are to ponder some reflection questions before listening to the lecture component. These questions aim to stimulate your thinking and focus your concentration on the topics to be explo ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question healthcare ethics and healthcare reformaccording

Question: Healthcare Ethics and Healthcare Reform According to the American College of Emergency Physicians. (ACEP) (n.d.), "the enacted Affordable Care Act (PPACA) of 2010 has fueled ethical debate of several important ...

Question for this assignment you are to examine a topic of

Question: For this assignment you are to examine a topic of lifespan development connecting research and life. Below is a list of topics from which you are to select one for the Outline of the Final Paper and the Final P ...

4,153,160 Questions Asked
13,132 Experts
2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Recent Questions

Ask Homework Help/Study Tips Expert