Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

A 16-year-old female presents to a family physician to obtain a referral for family therapy. She is estranged from her mother and stepfather, who see the same physician. For many years, this patient responsibly cared for her four younger siblings while their single mother worked. Since her mother's marriage, the family has become involved in a fundamentalist church. The patient moved out when she felt the social and moral restrictions of the family's religion were too burdensome for her. The patient seemed quite mature; she maintained a 3.5 GPA, along with a part-time job. She demonstrated a genuine desire for reconciliation, and the therapy referral was provided.

She also requested and obtained a prescription for contraceptives during the visit, with the assurance that her sexual activity would be kept confidential. In follow-up, she reported that the therapist had informed her that if she mentioned anything about being sexually active with her adult partner, he would be obliged to report her to the state. The patient was very concerned about the conflict between this statement and the family physician's prior assurance of confidentiality.

Should this patient's confidentiality be broken?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91877226
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

The primary goal of your last assignment is to reflect on

The primary goal of your last assignment is to reflect on what you have learned about yourself as a result of this class and how you will use this knowledge to succeed in future courses. Reflecting on your thoughts, feel ...

Question 1 what are the two sources of ideas and how do

Question: 1. What are the two sources of ideas, and how do they operate? 2. Discuss primary and secondary qualities of things & how their ideas are formed in the mind. 3. Discuss Locke's views on learning, memory, and fo ...

Explain what you do or will do to satisfy this

Explain what you do or will do to satisfy this competency. The statement should demonstrate your ability to meet the specific needs of this area. it should be written in the first person and use your own words. Use parag ...

Asume the role of a senator in florida you live in miami

Assume the role of a senator in Florida. You live in Miami. You have a meeting with the governor to discuss an increase in violent crime in Miami, including college campuses. He has asked for your input as he prepares hi ...

275 words answer all questions 2 websites or sourceshave

275 words. answer all questions 2 websites or sources Have you started researching about how to apply for adatabase manager job? Use a resource you need, including interviewing a database manager, career counselor, or re ...

Write at least 2 full pages and no more than 3 page essay

Write at least 2 FULL pages and no more than 3 page essay on how to process a crime scene. You may choose any type of crime scene. It must be typed, Times New Roman (12) point font, standard one inch margins, and double ...

Topic scenario analysis assignmentdirectionsread the four

Topic : Scenario Analysis Assignment Directions:Read the four scenarios below. Provide a 75-150-word response to each questionin all four of the scenarios presented below. Use the ACA and NAADAC Codes of Ethics and other ...

Background gc owners recognize the importance of effective

Background: GC owners recognize the importance of effective recruitment and hiring. They feel competent recruiting and hiring new GC management and other employees but want to hire an expert to recruit and hire cleaning ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question lenders perceive that you are risky so you must

Question: Lenders perceive that you are risky, so you must pay 12 percent annual interest to borrow from one of them. You only receive 6 percent on funds you have deposited in the bank. Do the opportunity costs of borrow ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As