Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1.Let us assume that Socrates, Plato, Aristotle, Descartes, Locke, and Hume kept daily diaries of their thoughts.

Choose one of the ancient Greek philosophers (Socrates, Plato, or Aristotle) and one of the modern European philosophers or protopsychologists (Descartes, Locke, or Hume).

Write a diary page (500-word maximum) from each of these gentlemen that discusses a central theme in their respective beliefs. Be creative, but stay factual.

Make sure that you evaluate the points of view or central themes you have identified for each of the two philosophers you have chosen.

Include material that illustrates the culture and time period in which they lived. Analyze the influences of social and cultural conditions on the philosophers.

Describe how the different perspectives from the different time periods led to distinctive beliefs about social issues.

You do not need an index or abstract for this paper. Use the APA Style Paper Template linked in the Resources.

· Written communication is free of errors that detract from the overall message.

· Resources and citations are formatted according to APA (6th Edition) style and formatting.

· Font and font size: Times New Roman, 12 point.

Discussion #1.Discuss how Thomas Upham built upon the work of John Locke and Thomas Reid. How did British empiricism and Scottish realism influence the development of the American Mental philosophers?

Discussion #2.Psychology is a relatively young science, with the first psychology laboratory being opened in 1879, but its roots extend back thousands of years to the ancient Greek philosophers. Psychology's roots are closely related to both biology and philosophy.

Because of its hybrid heritage, psychology is often considered a social science, a natural science, and part of the humanities.

What are the benefits of this complex heritage? What are the drawbacks? Why is it important to study the history of psychology?

How does the history of psychology inform modern day psychology?

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92631119

Have any Question?


Related Questions in Homework Help/Study Tips

Discussion questions submit your response to the question

Discussion Questions: Submit your response to the question to the appropriate Discussion Area by the due date assigned. Through the end of the module, comment on the responses of others. You will be attempting two discus ...

Question using the case study below develop a 3 - 5 page

Question: Using the case study below, develop a 3 - 5 page paper that is well organized and provides specific answers to each part of the assignment. Your answer is to be complete and is to demonstrate your understanding ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Assignment task -examine the issue of potentially

Assignment Task - Examine the issue of potentially outsourcing legal services to another country. Write an analysis that addresses the following questions: What are some of the variables associated with outsourcing legal ...

Question you are serving on a committee to select a course

Question: You are serving on a committee to select a course management system for use in educating and training your faculty, students, or employees. The concept of standards has come up. While you are familiar with SCOR ...

Question go to the geico website to read the total rewards

Question: Go to the Geico Website to read the "Total Rewards Program Write a five to seven (5-7) page paper in which you: 1. Determine which facets of the Geico total rewards program align with the five (5) top advantage ...

Question the constitution amp health care 20 points

Question: The Constitution & Health Care (20 points possible). For this assignment I want you to research and write a 2 page paper which should include: A description of what medicine and health care consisted of in the ...

Part 1write 400-600 words that respond to the following

Part 1 Write 400-600 words that respond to the following questions with your thoughts, ideas, and comments. This will be the foundation for future discussions by your classmates. Be substantive and clear, and use example ...

Quesiton the purpose of this assessment is to discuss and

Quesiton: The purpose of this assessment is to discuss and analyze your leadership development based on the Kouzes and Posner (2017) model. This model includes five (5) Practices of exemplary leadership (modelling the wa ...

Assignment -a new floating aquaculture facility has been

Assignment - A new floating aquaculture facility has been proposed in Long Island Sound in deep water directly south of the Connecticut River. This facility will be a moored facility - anchored by a four-legged tubular s ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As