Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1. Which of the following BEST describes the economy during Clinton's terms?
Answer One of the strongest and longest economic booms in American history
An economy with a strikingly large federal deficit
A stagnant economy that saw little growth
One of the largest and most reaching recessions in American history

2. Clinton faced impeachment charges for:
Answer providing false testimony under oath, witness tampering, and obstruction of justice.
the Whitewater scandal.
the Paula Jones scandal.
supporting Hillary's health care initiative

3. In the presidential election of 2000, which candidate won the popular vote?
Answer Al Gore
George W. Bush
John Kerry
Ross Perot

4. The Oklahoma City bombing was Timothy McVeigh's response to:
Answer American foreign policy.
the destruction of the Branch Davidians in Waco.
the World Trade Center bombing.
9/11.

5. Which term describes the belief that world-wide processes were causing national economies, cultures, and borders to "melt away"?
Answer Affirmative action
Deregulation
Détente
Globalization

6. All of the following were terrorist attacks in the continental United States EXCEPT:
Answer the 1995 federal building bombings.
the 1993 World Trade Center attack.
the 1998 car bombings outside of embassies.
the early 1990s bombings of abortion clinics

7. During Bush's administration, a new cabinet position was created called the:
Answer Department of Transportation.
Department of Homeland Security.
Department of Energy.
Department of Labor.

8. Place the events listed in their proper chronological order.
Answer - 1. 2. 3. 4. 5.
Welfare Reform Act

- 1. 2. 3. 4. 5.
North American Free Trade Agreement

- 1. 2. 3. 4. 5.
Immigration Reform and Control Act

- 1. 2. 3. 4. 5.
Proposition 187

- 1. 2. 3. 4. 5.
USA Patriot Act

9. This course has covered American history from the presidency of Andrew Johnson to George W. Bush. In this period, 26 men served as president. In an essay of 500-600 words, which president do you think left the boldest mark on American History? Why? Your essay should present the events that serve as a hallmark to his career and a clear explanation of not only the events but also their impact upon the course of American history.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92503188
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

After completing the lecture and reading assignments

After completing the lecture and reading assignments, develop a 750-1000 word written response paper to the following question. Do not use the question in your response. Discuss the concept of "quality of life". Elaborat ...

Question the brain and sensation and perception seeing is

Question: The Brain and Sensation and Perception: Seeing Is Believing? To prepare for this discussion, please read Chapters 2 and 3 of your textbook. In addition, watch Perspective: Brain Games (Season 6) and the Charlie ...

Question find a speech online and critique the presenters

Question: Find a speech online and critique the presenter's non-verbal communication habits throughout the presentation. Based on your readings and class discussions, write a ONE PAGE paper explaining how the presenter u ...

For this assignment i am during unicef protecting the

For this assignment I am during UNICEF protecting the World's Children Assignment : Researching Cultural Challenges Case Study Scenario: You have been hired by XYZ University as a consultant. They want you to evaluate an ...

Question have you ever behaved in a way that went against a

Question: Have you ever behaved in a way that went against a belief or value that you have? Why did this happen? What influenced your behavior in that moment? When we understand our own reasons for going against our beli ...

Question by successfully completing this assessment you

Question: By successfully completing this assessment, you will demonstrate your proficiency in the following course competencies and assessment criteria: Competency 2: Evaluate the characteristics, purposes, benefits, st ...

Wtch the video provided then answer the questionsvideo

Watch the video provided, then answer the questions. Video : How to make stress your friend By Kelly McGonigal | TEDGlobal 2013 Consider the information you have learned in class so far. Also consider after watching the ...

Assessment task - planning implementation and evaluation of

Assessment task - Planning, implementation and evaluation of a non-communicable disease prevention initiative This assignment uses a suburban state primary school as a setting for the prevention of overweight and obesity ...

Question what is sampling theory describe it and provide

Question: What is sampling theory? Describe it and provide examples to illustrate your definition. Discuss generalizability as it applies to nursing research. The response must be typed, single spaced, must be in times n ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As