Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1. Use the DNA Template to replicate the DNA - Fill in the direction (ends) and the complementary base pairs.

99_Figure.png

2. Use the NEWLY SYNTHESIZED strand of DNA into mRNA (You are using your answer in #1 for your template to make the mRNA) - Fill in the direction (ends) and complementary base pairs.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

3. Translate your transcript (answer for #2) into a protein. Use Figure 13-5 from your text (The Genetic Code) to help you. You need to pay attention to where you are supposed to start.  Each box will have one letter for the 3 letter abbreviation for the specific amino acid. For example if your codons (on top) are the following codons, your amino acids would be (in gray):

A

A

U

G

U

C

U

U

U

C

U

G

A

 

 

M

E

T

S

E

R

P

H

E

STOP

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

4. Within the protein lies a word related to a type of mutation.  Beginning with the amino acid that follows methionine, use 1 letter from each amino acid to decipher the secret word.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M91951530

Have any Question?


Related Questions in Homework Help/Study Tips

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question a firm that maintains the same organizational

Question: A firm that maintains the same organizational structure for too long may become a competitive loser, but so might one that changes its structure too frequently. Explain. The response must be typed, single space ...

Question 1please briefly introduce the state childrens

Question: 1. Please briefly introduce the State Children's Health Insurance Program (SCHIP) of Kansas state of residence. 2. What kind of services are covered? 3. What are the eligibility? 4. How does SCHIP differ from y ...

Assessment d - case studycase studyjjs bistro is located in

ASSESSMENT D - CASE STUDY Case study JJ's Bistro is located in Jackson's hotel. It seats 210 people and is open for lunch and dinner, seven days a week. The hotel promotes a family environment and has a playroom for youn ...

Read the following information sheetsalliances and

Read the following information sheets: Alliances and Codeshares/U.S. Department of Transportation Code Share Fact Sheet/U.S. General Services Administration Write a one-page (not including cover and reference pages) APA- ...

Assignment 3 gender identitywe are socialized at every

Assignment 3: Gender Identity We are socialized at every stage in life to conform to our gender identity. Societal reinforcement of tendencies of gender identity is relentless. For example, in hospitals, little girls are ...

Question instructions for this assignment you are to ponder

Question: Instructions: For this assignment, you are to ponder some reflection questions before listening to the lecture component. These questions aim to stimulate your thinking and focus your concentration on the topic ...

Question what is the self-directed learning issue that was

Question: What is the self-directed learning issue that was identified in your oral presentation? Management in a patient who has to frequently self-catheterize. Research the self-directed learning issue and provide a su ...

When considering parenting styles there is a tendency to

When considering parenting styles there is a tendency to think that both parents use the same parenting style. This is often not true! In particular, when parents are divorced or there is a single parent who visits with ...

According to the text white-collar crime refers to offenses

According to the text, white-collar crime refers to offenses committed by workers in the course of their commercial activities. In this case study, you will explore white-collar crime as committed by Julian Assange. Read ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As