Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1. Mrs.Bee is admitted to Anytown Hospital.Mr.Smith, a staff nurse, unknowingly clips the wrong chart to Mrs.Bee's bed.Mrs.Jones, the medication nurse, later enters the patient's room, looks at the chart, and injects the patient with the wrong medication.In an action in tort, judgment would be for
Mrs. Bee's physician
Mrs. Bee
the hospital
medication nurse

2. A nurse fails to keep a patient's bedrails in the upright position as ordered by the attending physician. The patient is discharged having never fallen from the bed.What elements of negligence are present?
duty to care
breach of duty
injury
causation
a and b above
none of the above

3. A nurse treating a patient who exhibiting signs of an allergic reaction to a medication should
continue to administer the medication for the patient's good health
make his or her best decision as to an alternate medication
call the pharmacy and obtain an alternate medication
contact the attending physician

4. Burns by hot water bottles, sitz baths, and heating pads are common everyday occurrences and are not considered negligent acts.
True
False

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M92469149
  • Price:- $10

Priced at Now at $10, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Discussion theories of life-span development post a

Discussion: Theories of Life-Span Development Post a Discussion in which you analyze the theory of life- span development that you selected. Summarize the theory; then, identify the strengths and weaknesses of this theor ...

Question given the opinion polls cited by boyer explain the

Question: "Given the opinion polls cited by Boyer, explain the relationship between educational levels and attitudes towards both the Hiroshima and Nagasaki bombings and the prospect of nuclear technologies." The respons ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Foundations of strategic management please respond to the

"Foundations of Strategic Management" Please respond to the following: Analyze the concepts of strategic planning and strategic management. Determine two fundamental differences between the concepts that you have analyze ...

Question in 1500-2000 words describe the teaching

Question: In 1,500-2,000 words, describe the teaching experience and discuss your observations. The written portion of this assignment should include: 1. Summary of teaching plan 2. Epidemiological rationale for topic 3. ...

Discussion 1 describe what you learned about the impact of

Discussion 1: Describe what you learned about the impact of economic, social, and demographic trends affecting the US labor environment. Use at least one reference and interact with at least two classmates. Discussion 2: ...

1 the development of values in the organization starts with

1. The development of values in the organization starts with management along with the company's policies. "Culture of ethics is an atmosphere or ethos that promotes the ideal that a business's employees will behave in a ...

Question find a speech online and critique the presenters

Question: Find a speech online and critique the presenter's non-verbal communication habits throughout the presentation. Based on your readings and class discussions, write a ONE PAGE paper explaining how the presenter u ...

In chapter 7 of your course text the authors lay out a

In Chapter 7 of your course text, the authors lay out a series of guidelines and suggested procedures for directors to follow as they recruit, interview, and hire candidates for positions in their child development cente ...

Assignmentestablishing classroom procedures and

Assignment Establishing classroom procedures and implementing routines in the classroom help to manage the classroom and optimize time for instruction and efficient learning. Classroom procedures and routines should chan ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As