Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1) Create a PowerPoint presentation of 6 slides, 3 slides for each in which you compare the pros and cons of continuing nursing education related to the following:

  • Impact on knowledge and attitudes.
  • Relationship to professional certification.

Should continuing nursing education be mandatory for all nurses? Support your position with rationale.

A minimum of three scholarly souces are required for this assignment.

While APA format is not required for the body of this assignment, solid academic writing is expected and in-text citations and references should be presented using APA documentation guidelines, which can be found in the APA Style Guide, located in the Student Success Center.

This assignment uses a grading rubric. Instructors will be using the rubric to grade the assignment; therefore, students should review the rubric prior to beginning the assignment to become familiar with the assignment criteria and expectations for successful completion of the assignment.

2) As you have discovered through this course, nurses are influential members of the community and the political system. Therefore, for the purposes of this assignment you will identify a problem or concern in your community, organization, etc. that has the capacity to be legislated. You will conduct research and state a proposal. Through the legislative process, your proposal for the problem or concern may influence an idea for change into a law.

First, refer to the "How a Bill Becomes a Law" media.

http://lc.gcumedia.com/zwebassets/courseMaterialPages/nrs440v_how-a-bill-becomes-a-law-v2.1.php

Then, view the "Bill to Law Process" to watch the scenario.

After viewing the scenario, refer to the "Legislative Assignment." You will need to save the document first in order to use it.

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9795848
  • Price:- $40

Priced at Now at $40, Verified Solution

Have any Question?


Related Questions in Homework Help/Study Tips

Question discuss the philosophical and religious origins of

Question: Discuss the philosophical and religious origins of the Gothic style of the Middle Ages. What are the identifying elements of this style? The response must be typed, single spaced, must be in times new roman fon ...

Question 1 - private capital expenditure for 12 successive

Question 1 - Private capital expenditure for 12 successive quarters are presented in the following table: Quarter Millions     1 31,920 2 25,120 3 30,350 4 24,650 5 30,090 6 23,980 7 28,450 8 26,710 9 31,380 10 27,260 11 ...

Question unionization has been on a relatively slow yet

Question: Unionization has been on a relatively slow yet steady decline. Given the change in the workforce dynamics, speculate what segment(s) or types of employees would likely gravitate toward unionization in the curre ...

Question for each of the following purchases say whether

Question: For each of the following purchases, say whether you would expect the degree of imperfect information to be relatively high or relatively low: a. Buying apples at a roadside stand b. Buying dinner at the neighb ...

Law enforcement did not always have the tools for gathering

Law enforcement did not always have the tools for gathering all information needed to prepare a case. Throughout time, laws have been made to secure the rights of criminal investigators to obtain the material needed to s ...

The way the teacher introduces and reinforces procedures

The way the teacher introduces and reinforces procedures, technology, and behavior expectations sets the stage for building the community within the classroom. When teachers have clear and consistent procedures and expec ...

Assignment 1 discussion-the advantages and disadvantages of

Assignment 1: Discussion-The Advantages and Disadvantages of Free Trade Many Americans feel that their jobs at home should be protected and that free trade should be limited. However, global competition and less expensiv ...

Assignment 1 lasa 2-self-help evaluationthe self-help

Assignment 1: LASA 2-Self-Help Evaluation The self-help movement has swept the world of substance abuse treatment. A new client may not be aware of any treatment options open to them aside from those of self-help group m ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

Question how does ideal culture differ from real culture

Question: How does ideal culture differ from real culture? Write your essay using three examples of how ideal and real culture differ in U.S. society. The response must be typed, single spaced, must be in times new roman ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As