Ask Question, Ask an Expert

+61-413 786 465

info@mywordsolution.com

Ask Homework Help/Study Tips Expert

1) A quasi-experimental research design that looks much like an experiment but lacks randomized assignment of subjects to treatment conditions is known as...?

A. Interrupted Time Series Design

B. Repeated Measure Design

C. Nonequivalent Control Group Design

D. Ad Hoc Design

2) An idiographic method of research focuses upon...?

A. An individual

B. A specific problem

C. A particular contextual setting

D. A particular group

3) Anything that can be identified as varying in assigned value can be a ...?

A. Hypothesis

B. Perspective

C. Variable

D. Constant

4) One reason given for Mixed Method Research is to bring richness and detail to the study exploring specific features of each method. This purpose is referred to as...?

A. Complementarity

B. Triangulation

C. Development

D. Expansion

5) Positivist and Post-Positivist perspectives on research adhere to the perspective of Philosopher of Science Karl Popper, who held that all stated research hypotheses must be...?

A. Stated in a manner that excludes the self as a means of reducing bias

B. Simply stated to avoid misinterpretation

C. Self-contained in relationship to the complexity of the study

D. Falsifiable based upon empirical evidence obtained through scientific procedures

6) A design method in quantitative research that is used to control for order of effects without having all possible orders is called...?

A. Analysis of Covariance

B. Chi Square

C. Latin Squares

D. Repeated measures

7) Where "R" = Random Assignment Subjects to Treatment conditions; "NR" = No Random Assignment; "X" = Treatment and "O" = Observation, which of the following allows for causal inferences to be made regarding the effect of treatment?

A.

R X O

R _ O

B.

R X O

C.

NR X O

NR _ O

D.

NR O X O

8) Time focus of a research design can involve assessing a condition and looking backwards to subject history, or assessing a condition and looking forward to the effects the come manifest over time. This is known as...?

A. Inward, Outward

B. Retrospective, Prospective

C. Artifactual, Speculative

D. Focused, Unfocused

9) To be applicable to meaningful research, a "research question" must be...?

A. Purposeful in direction of what is being asked

B. Positive in formulation

C. Answerable within the scope of chosen research practices, instrumentation and procedures

D. Legitimate within the scope of existing societal values toward research

10) Three common and well known methods of data collection for Qualitative Research Designs are...?

A. Surveys, psychometric tests, rating scales

B. Interactive interviewing, written descriptions by participants, observation

C. Video recording, computer files, Internet

D. Spatial recording, artifact review, non-specific archeology

11) Name a qualitative research design that focuses in-depth upon a single case example of the phenomena being studied that can be an individual person, an event, a group, or an institution.

A. Case study

B. Phenomenology

C. Ethnographic analysis

D. Narrative analysis

12) A Cross-sectional method studies an issue of interest at...?

A. Continuously

B. Several points in time

C. A single point in time

D. Over a duration of time

13) Qualitative research with human subjects typically involves __________ and __________ without specific forms of scaled measurement.

A. artifacts, traces

B. tests, critical items

C. interviews, observations

D. instruments, interests

14) A single group pretest - posttest research design cannot infer causality of relationship because...?

A. Too few subjects are involved in the research process under this design

B. There are no means of eliminating alternative explanations for the observed changes in contrast to a treatment effect because there is no random assignments to treatment and control groups

C. There are too few groups to conduct an Analysis of Variance

D. Correlation does not equal causation

15) A cross between a cross sectional design and longitudinal design is known as...?

A. A single case design

B. A reversal design

C. A sequential design

D. Matched pairs design

Homework Help/Study Tips, Others

  • Category:- Homework Help/Study Tips
  • Reference No.:- M9788830

Have any Question?


Related Questions in Homework Help/Study Tips

At least 100 wordsif given the choice would you purchase an

At least 100 words. If given the choice, would you purchase an unusual car such as a hearse for everyday use? Is this a form of social deviance and how is that normally controlled by society? How is it different from a c ...

Question extraneous variables may have an influence on the

Question: Extraneous variables may have an influence on the dependent variable. In what ways do researchers attempt to control extraneous variables? Support your answer with current literature. The response must be typed ...

Question this podcast preventing malnutrition addressing

Question: This podcast, Preventing Malnutrition: Addressing Undernutrition in Young U.S. Children by Dr. Robert Murray, will provide a good foundation for understanding child nutrition and growth challenges. Please liste ...

Question based on how you will evaluate your ebp project

Question: Based on how you will evaluate your EBP project, which independent and dependent variables do you need to collect? Why? The response must be typed, single spaced, must be in times new roman font (size 12) and m ...

Essay assignment -topic why is project governance critical

Essay Assignment - Topic: Why is Project Governance Critical to the Success of a Project? Background to the Assessment - In a paper  presented at PMI Global Congress 2015 - North America, Salina Alie stated the following ...

Question diversity among individuals as well as cultures

Question: Diversity among individuals, as well as cultures, provides a challenge for nurses when it comes to delivering meaningful health promotion and illness prevention-based education. How do teaching principles, vari ...

Question your textbook does an excellent job of reviewing

Question: Your textbook does an excellent job of reviewing the significance of the environmental health laws in the United States. They are as follows: a) CERCLA b) Clean Air Acts c) Clean Water Act d) Endangered Species ...

1-what are the crucial factors to take into consideration

1- What are the crucial factors to take into consideration in the internal security level of a country when it makes a visa-free reciprocity agreement with other countries? 2- What are the advantages/disadvantages of thi ...

Question ann a community nurse made an afternoon home visit

Question: Ann, a community nurse, made an afternoon home visit with Susan and her father. After the death of her mother, Susan had growing concerns about her father living alone. "I worry about my father all the time. He ...

This dna molecule 5 - tagcctagctccggcgtagcggcaattaatgat - 3

This DNA molecule: 5' - TAGCCTAGCTCCGGCGTAGCGGCAATTAATGAT - 3' 3' - ATCGGATCGAGGCCGCATCGCCGTTAATTACTA - 5' is incubated with this primer: 5' - ATCATTAA - 3' plus 100mM each dATP, dTTP, dCTP, dGTP, and 1mM ddATP (note:did ...

  • 4,153,160 Questions Asked
  • 13,132 Experts
  • 2,558,936 Questions Answered

Ask Experts for help!!

Looking for Assignment Help?

Start excelling in your Courses, Get help with Assignment

Write us your full requirement for evaluation and you will receive response within 20 minutes turnaround time.

Ask Now Help with Problems, Get a Best Answer

Why might a bank avoid the use of interest rate swaps even

Why might a bank avoid the use of interest rate swaps, even when the institution is exposed to significant interest rate

Describe the difference between zero coupon bonds and

Describe the difference between zero coupon bonds and coupon bonds. Under what conditions will a coupon bond sell at a p

Compute the present value of an annuity of 880 per year

Compute the present value of an annuity of $ 880 per year for 16 years, given a discount rate of 6 percent per annum. As

Compute the present value of an 1150 payment made in ten

Compute the present value of an $1,150 payment made in ten years when the discount rate is 12 percent. (Do not round int

Compute the present value of an annuity of 699 per year

Compute the present value of an annuity of $ 699 per year for 19 years, given a discount rate of 6 percent per annum. As